Oligomap

1. Introduction
2. Installation
3. Usage
4. Output Format
5. Test data
6. Citing Oligomap
7. License

Introduction

Oligomap is a program for fast identification of nearly-perfect matches of small RNAs in sequence databases. It allows to exhaustively identify all the perfect and 1-error (where an error is defined to be a mismatch, insertion or deletion) matches of large sets of small RNAs to target sequences.

NOTE: Optimal performance is achieved at about 500000 query sequences. This will require ~2GB of memory.

Installation

With Conda

Oligomap can be installed using package manager Conda, which needs to be installed on your system before proceeding.

conda install -c bioconda oligomap

With Docker

You can create a new container using the docker platfrom, which needs to be installed on your system, from the oligomap image with the command:

docker pull quay.io/biocontainers/oligomap:1.0.1--hdcf5f25_0

Building from source

To install oligomap, you must ensure you have installed in your system autoconf, automake, cmake and libtool. If you don't, you can install them with the command:

sudo apt-get install libtool cmake automake autoconf

In addition, you need to ensure that the g++ compiler has the minimum version 11.3.0. Once these dependencies are available, traverse to the desired path on your file system, then clone the repository and change into it with:

git clone https://github.com/zavolanlab/oligomap.git
cd oligomap

In order to build the program, traverse to the install directory and use the commands:

./configure
make

If you have root permissions you can install oligomap with the command:

sudo make install

Usage

Oligomap is a command line program that requires at least two arguments:

• target.fa. Target sequences we want to map the library against.
• query.fa. Small RNA sequence library to be mapped.

In addition, the available arguments are:

Flag	Meaning
-s	scan only plus strand of the target
-d	scan all .fa target files in a directory (target.fa must be a directory)
-r PATH	create a match report at the end
-m INT	maximum hits for one query to print

NOTE: By default, the output is printed to the STDOUT. To keep the results the output must be redirected.

If you just built the program, you can run it from the directory where the executable is with the command:

./oligomap target.fa query.fa

If you installed oligomap using Conda or with make install, you can run it from any directory with the command:

oligomap target.fa query.fa

If you had pulled the docker image, you can run oligomap using the command:

docker run oligomap target.fa query.fa

Output format

Oligomap returns the alignment's data in 6 lines:

• The first line contains the read's name, its length, the start and end mapped positions in the read's sequence, the reference sequence name and, the start and end mapped positions in the reference sequence in this order.
• The second line, contains the reference sequence name.
• The third line, contains the fields "errors:" and "orientation:" with the alignment's number of errors and reference sequence strand.
• The fourth and sixth lines are the read and reference sequences respectively.
• The fifth line contains a vertical bar for each match between the sequences base pairs or a space otherwise.

Alignments are separated with a blank line.

Below is an example consisting of two output records:

    read_1 (23 nc) 1..23	ref_chr_19	44377..44398
    ref_chr_19
    errors: 1 orientation: +
    CTACAAAGGGAAGCACTTGTCTC
    |||||||||||||||||| ||||
    CTACAAAGGGAAGCACTT-TCTC


    read_2 (22 nc) 1..22	ref_chr_19	5338..5359
    ref_chr_19
    errors: 0 orientation: -
    TCAAAACTGAGGGGCATTTTCT
    ||||||||||||||||||||||
    TCAAAACTGAGGGGCATTTTCT

The report created when setting the flag -r PATH consists of a three-field table with the following content:

• The read's name
• The number of alignments found for that read with no errors
• The number of alignments found for that read with a single error

For example:

    read_1   0   2
    read_2   3   1
    read_3   0   0

Test data

Under the test directory you can find test data. Consult the README file located there for usage examples.

Citing Oligomap

If you use oligomap in your research, please cite:

Berninger P, Gaidatzis D, van Nimwegen E, Zavolan M. 
"Computational analysis of small RNA cloning data", Methods, 44(13-21), 2008

License

This project is covered by the GPL-3.0 License.