-
Notifications
You must be signed in to change notification settings - Fork 0
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #18 from moka-guys/v1.3.0
V1.3.0 (#18) Co-Authored-By: Graeme <[email protected]> Co-Authored-By: rebeccahaines1 <[email protected]>
- Loading branch information
Showing
11 changed files
with
124 additions
and
62 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -1,2 +1,2 @@ | ||
[pytest] | ||
addopts = -v --ignore=test/data/ --ignore=test/temp/ --cov=. --cov-report term-missing --sequencer_ids=NB551068,NB552085,M02353,M02631,A01229 --tso_panels=Pan4969,Pan5085,Pan5112,Pan5114 --dev_panno=Pan5180 --panels=Pan5180,Pan4009,Pan2835,Pan4940,Pan4396,Pan5113,Pan5115,Pan4969,Pan5085,Pan5112,Pan5114,Pan5007,Pan5008,Pan5009,Pan5010,Pan5011,Pan5012,Pan5013,Pan5014,Pan5015,Pan5016,Pan4119,Pan4121,Pan4122,Pan4125,Pan4126,Pan4974,Pan4975,Pan4976,Pan4977,Pan4978,Pan4979,Pan4980,Pan4981,Pan4982,Pan4983,Pan4984,Pan4821,Pan4822,Pan4823,Pan4824,Pan4825,Pan4149,Pan4150,Pan4129,Pan4964,Pan4130,Pan5121,Pan5185,Pan5186,Pan5143,Pan5147,Pan4816,Pan4817,Pan5122,Pan5144,Pan5148,Pan4819,Pan4820,Pan4145,Pan4146,Pan4132,Pan4134,Pan4136,Pan4137,Pan4138,Pan4143,Pan4144,Pan4151,Pan4314,Pan4351,Pan4387,Pan4390,Pan4826,Pan4827,Pan4828,Pan4829,Pan4830,Pan4831,Pan4832,Pan4833,Pan4834,Pan4835,Pan4836 --logdir=. | ||
addopts = -v --ignore=test/data/ --ignore=test/temp/ --cov=. --cov-report term-missing --sequencer_ids=NB551068,NB552085,M02353,M02631,A01229 --tso_panels=Pan5085,Pan5112,Pan5114 --dev_pannos=Pan5180,Pan5227 --panels=Pan5180,Pan4009,Pan2835,Pan4940,Pan4396,Pan5113,Pan5115,Pan5226,Pan5085,Pan5112,Pan5114,Pan5007,Pan5008,Pan5009,Pan5010,Pan5011,Pan5012,Pan5013,Pan5014,Pan5015,Pan5016,Pan4119,Pan4121,Pan4122,Pan4125,Pan4126,Pan4974,Pan4975,Pan4976,Pan4977,Pan4978,Pan4979,Pan4980,Pan4981,Pan4982,Pan4983,Pan4984,Pan4821,Pan4822,Pan4823,Pan4824,Pan4825,Pan4149,Pan4150,Pan4129,Pan4964,Pan4130,Pan5121,Pan5185,Pan5186,Pan5143,Pan5147,Pan4816,Pan4817,Pan5122,Pan5144,Pan5148,Pan4819,Pan4820,Pan4145,Pan4146,Pan4132,Pan4134,Pan4136,Pan4137,Pan4138,Pan4143,Pan4144,Pan4151,Pan4314,Pan4351,Pan4387,Pan4390,Pan4826,Pan4827,Pan4828,Pan4829,Pan4830,Pan4831,Pan4832,Pan4833,Pan4834,Pan4835,Pan4836 --logdir=. |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,37 @@ | ||
{ | ||
"python.testing.pytestArgs": [ | ||
"." | ||
], | ||
"python.testing.unittestEnabled": false, | ||
"python.testing.pytestEnabled": true, | ||
"python.envFile": "${workspaceFolder}/.venv", | ||
"python.analysis.extraPaths": [ | ||
], | ||
"editor.formatOnSaveMode": "file", | ||
"editor.formatOnSave": true, | ||
"editor.codeActionsOnSave": { | ||
"source.organizeImports": "explicit" | ||
}, | ||
"[python]": { | ||
"editor.defaultFormatter": "ms-python.black-formatter", | ||
"editor.formatOnSave": true, | ||
"editor.codeActionsOnSave": { | ||
"source.organizeImports": "explicit" | ||
} | ||
}, | ||
"isort.args": [ | ||
"--profile", | ||
"black" | ||
], | ||
"flake8.args": [ | ||
"--max-line-length=120" | ||
], | ||
"pylint.args": [ | ||
"--max-line-length=120" | ||
], | ||
"black-formatter.args": [ | ||
"--line-length", | ||
"120" | ||
], | ||
"python.analysis.typeCheckingMode": "basic" | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
27 changes: 27 additions & 0 deletions
27
test/data/samplesheets/valid/231012_M02631_0285_000000000-ERTFB_SampleSheet.csv
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,27 @@ | ||
[Header],,,,,,,,, | ||
IEMFileVersion,4,,,,,,,, | ||
Investigator Name,DEV01,,,,,,,, | ||
Experiment Name,DEV01,,,,,,,, | ||
Date,12/10/2023,,,,,,,, | ||
Workflow,GenerateFASTQ,,,,,,,, | ||
Application,FASTQ Only,,,,,,,, | ||
Assay,Nextera XT,,,,,,,, | ||
Description,DEV01,,,,,,,, | ||
Chemistry,Amplicon,,,,,,,, | ||
,,,,,,,,, | ||
[Reads],,,,,,,,, | ||
251,,,,,,,,, | ||
251,,,,,,,,, | ||
,,,,,,,,, | ||
[Settings],,,,,,,,, | ||
ReverseComplement,0,,,,,,,, | ||
Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,,,,,,,, | ||
AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,,,,,,,, | ||
,,,,,,,,, | ||
[Data],,,,,,,,, | ||
Sample_ID,Sample_Name,Sample_Plate,Sample_Well,I7_Index_ID,index,I5_Index_ID,index2,Sample_Project,Description | ||
DEV01_01_000000_0000000_Pan5227,DEV01_01_000000_0000000_Pan5227,,,IDT8_UDI_1_2,CTGATCGT,IDT8_UDI_1_1,ATATGCGC,, | ||
DEV01_02_000000_0000000_Pan5227,DEV01_02_000000_0000000_Pan5227,,,IDT8_UDI_2_2,ACTCTCGA,IDT8_UDI_2_1,TGGTACAG,, | ||
DEV01_03_000000_NTC0000_Pan5227,DEV01_03_000000_NTC0000_Pan5227,,,IDT8_UDI_3_2,TGAGCTAG,IDT8_UDI_3_1,AACCGTTC,, | ||
DEV01_04_000000_0000000_Pan5227,DEV01_04_000000_0000000_Pan5227,,,IDT8_UDI_4_2,GAGACGAT,IDT8_UDI_4_1,TAACCGGT,, | ||
DEV01_05_000000_0000000_Pan5227,DEV01_05_000000_0000000_Pan5227,,,IDT8_UDI_5_2,CTTGTCGA,IDT8_UDI_5_1,GAACATCG,, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters