3.21 Add calculation of GDT_TS and GDT_HA

GTSRNA Global Distance Test modified for RNA, with adapted thresholds of 1.5, 3.0, 6.0, and 12 (instead of the 1, 2, 4, 8 Å used in protein comparisons, due to the larger average distance between phosphorus atoms than between C- atoms) is computed on backbone phosphorus atoms instead of C-. To compute this score, we patched the TMscore program used for computing protein structure similarity scores for protein models [42] (see patch in File S3).

https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0078007
Full Changelog: 3.21...3.21

3.20 PyMOL4RNA.py: improve pdb

3.18 PyMOL4RNA: better Sugar edge

Connect atoms to C1' instead of O2'.

3.17 Torsion angle analysis

Examples:

$ rna_torsions.py ./input/4GXY_min.pdb
f, alphaprime, beta
input ./input/4GXY_min.pdb <Residue G het=  resseq=2 icode= >, -64.20924484900823, -143.18546007904766
input ./input/4GXY_min.pdb <Residue C het=  resseq=3 icode= >, 2.3394112025736815, 70.4052871669199

Comparison:

$ rna_x3dna.py input/4GXY_min.pdb -s
input: input/4GXY_min.pdb
   nt id   res  alpha   beta  gamma  delta  epsilon  zeta      e-z           chi     phase-angle sugar-type  ssZp    Dp  splay     paired
0   1  G  A.G2    NaN -143.2  153.7   82.5    -92.3 -31.9  -60(..)  -179.0(anti)  19.5(C3'-endo)  ~C3'-endo  4.39  4.56  18.32  no paired
1   2  C  A.C3 -111.4   70.4  160.0   80.6      NaN   NaN      NaN  -177.6(anti)  11.1(C3'-endo)  ~C3'-endo   NaN   NaN    NaN  no paired

rna_pdb_tools.py add --save-single-res --ref-frame-only

rna_pdb_tools.py --rpr input/4GXY_min.pdb --save-single-res --ref-frame-only

atoms presets:

  --backbone-only       used only with --get-rnapuzzle-ready, keep only backbone (= remove bases)
  --ref-frame-only      used only with --get-rnapuzzle-ready, keep only reference frames, OP1 OP2 P
  --no-backbone         used only with --get-rnapuzzle-ready, remove atoms of backbone (define as P OP1 OP2 O5')
  --bases-only          used only with --get-rnapuzzle-ready, keep only atoms of bases

to extract specific atoms for each residue and write them to separate PDB file

3.15 rna_pdb_tools.py --fetch-fasta 4gxy

rna_pdb_tools.py --fetch-fasta 4gxy
>4GXY_1|Chain A|Adenosylcobalamin riboswitch|null
GGCGGCAGGUGCUCCCGACCCUGCGGUCGGGAGUUAAAAGGGAAGCCGGUGCAAGU[...]

3.14 build RNAStructure from lines/scratch

Build an RNAStructure object from parsing a text input.

rna = RNAStructure()

l = rna.get_empty_line()
                
l = rna.set_res_code(l, <res>)
l = rna.set_atom_code(l, <atomname>)
l = rna.set_res_index(l, <resid>)
l = rna.set_atom_coords(l, <x, y, z>)
                
rna.add_line(l)
       
rna.write(args.output)

• still not the most pretty, but works...

3.13.x Refactor --get-rnapuzzle-ready into rna_standardize.py

$ rna_standardize.py rna_tools/input/comparison/*
Output: rna_tools/input/comparison/4GXY_min_std.pdb
>A:2-3
GC
Output: rna_tools/input/comparison/4GXY_min_reconstruction_std.pdb
>A:1-2
GC

3.12.x Rename rna_pdb_toolsx.py to rna_pdb_tools.py!

This will break some compatibility, but I think this was needed. This "x" was there to avoid previous problems with importing files when the package name was rna_pdb_tools. Since the package was renamed to rna-tools (and the main folder to rna_tools), this "x" should have been removed years ago ;-)

3.11.x Fix missing docs compilation

Replace sphinx-argparse with sphinxcontrib-autoprogram: docs: passing