-
Notifications
You must be signed in to change notification settings - Fork 0
fe-jackson/Find-Common-Subsequences
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
PROJECT TITLE: Find Common Subsequences DATE: November 21, 2020 AUTHOR: Fe Jackson PURPOSE OF PROJECT: This program was an assignment for a 200 level college course called Programming Systems. The assignment instructions were the following: "You will write a Java program that compares several DNA strands and looks for common subsequences among the strands. Each DNA strand consists of a sequence of bases (A, G, C, U) and is represented as a line of characters in an input file. For example, this would represent four DNA strands: UACUCGGAUGUUGCAGAG GACCAGUUAUACUCGUCUGAGAG UCUUACUCGGAUGCUAGAGCUAGGA CCUGGAGCACUCGCCUG A common subsequence is a sequence of bases where the same sequence of bases appears in all the strands. The common subsequence can be at any location in each strand. With the above example, a common subsequence is "ACUCG" and it appears in each of the strands (2nd, 11th, 5th, and 9th positions, respectively). We only consider common subsequences that are between 5 and 15 characters long, inclusivly. That is, we wouldn't count the "GAG" common subsequence even though it appears in each strand. The strands are of various lengths and there could be more than one common subsequence that appears in all of them. Your program will need to find all of the subsequences and then print them out in order from longest to shortest. See the output.txt file for the exact format and values. This assignment includes several data files containing DNA strands. All of the data files have the same subsequences in their DNA strands so the results from your program will be the same on all of the files (exactly what is in output.txt)." HOW TO START THIS PROJECT: Compile FindCommonSubsequences.java and ReadLines.java on any Java compiler. An example of a free Java compiler is a program called BlueJ. USER INSTRUCTIONS: Run the main function in the ReadLines class, passing it a string containing the path the text file containing the strings that the program will be comparing. The provided text files are "large.txt", "medium.txt", "small.txt", "verylarge.txt", and "verysmall.txt". Each provided file, when provided to the program, will prompt the same output from the program.
About
A program that finds substrings within a list of several strings
Topics
Resources
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published