You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
Describe the bug
hts_AdapterTrimmer and hts_PolyATTrim did not remove adapters in some reads that have incomplete, degeneracy or extra sequence in the adapter sequence of the 3' end of the reads
To Reproduce
Example sequence reads that will help reproduce the bug:
@A01488:145:HHFCKDSX5:4:1101:19895:1000_TATA_NTGGCT 1:N:0:TAACCAGCACTT+NATGTCGTTGGA
GAGTTTGTGATTTAAACATTTTGTTGTTAATAATATTGATATTGTATTTTCTTGAATGTGGAACTTTCTTTTTTATGCTTACGTACCAAAAAAAAAAAAAAAAAAAACGGAATAGCAAACGTCTTAAAACCAGTCAAAAA
Commands to reproduce the behavior:
module load miniconda
source activate process_reads
for x in ${umi_folder[@]}; do
y=${x##/}
echo Working on $y
hts_Stats -F -L ${log_folder}${y}.log -U ${x} | #read stats
hts_SeqScreener -AL ${log_folder}${y}.log | #remove contaminants
hts_AdapterTrimmer -AL ${log_folder}${y}.log | #trim adaptors
hts_PolyATTrim -AL ${log_folder}${y}.log |
hts_QWindowTrim -AL ${log_folder}${y}.log | #remove low-quality
hts_NTrimmer -AL ${log_folder}${y}.log | #remove Ns
hts_Stats -AL ${log_folder}${y}.log -f ${clean_folder}${y} #read stats and save cleaned
done
conda deactivate
module unload miniconda
Expected behavior
Since the Lexogen 3' end which consists of 5' – A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC – 3' (adepter sequence same as default TruSeq), we expect that the sequence of PolyA tail and adapetr sequence will be trimmed.
Screenshots
Desktop (please complete the following information):
OS: macOS Catalina 10.15.7 but terminal is connected to HPC
Additional context
Add any other context about the problem here.
The text was updated successfully, but these errors were encountered:
Describe the bug
hts_AdapterTrimmer and hts_PolyATTrim did not remove adapters in some reads that have incomplete, degeneracy or extra sequence in the adapter sequence of the 3' end of the reads
To Reproduce
Example sequence reads that will help reproduce the bug:
@A01488:145:HHFCKDSX5:4:1101:19895:1000_TATA_NTGGCT 1:N:0:TAACCAGCACTT+NATGTCGTTGGA
GAGTTTGTGATTTAAACATTTTGTTGTTAATAATATTGATATTGTATTTTCTTGAATGTGGAACTTTCTTTTTTATGCTTACGTACCAAAAAAAAAAAAAAAAAAAACGGAATAGCAAACGTCTTAAAACCAGTCAAAAA
@A01488:145:HHFCKDSX5:4:1101:25247:1000_TATA_NTGGGG 1:N:0:TAACCAGCACTT+NATGTCGTTGGA
TTGAGATGGGTGTTCCAAGAGTCGAATAGCTTGGGAATGCTGTTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATCGACGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAAAAAAAAAAAAAAAAAGATCG
@A01488:145:HHFCKDSX5:4:1101:7139:1016_TATA_TGAGTT 1:N:0:TAACCAGCACTT+AATGTCGTTGGA
TTGCTTTCATCATCCCTTTTACAGGGTGAAATTAATTGTTACTTTCAACAGATGCTTCTGATTAAAAAAAAAAAAAAAAAAAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTAACCAGCACTTATCTCGTTTGCCGGG
Commands to reproduce the behavior:
module load miniconda
source activate process_reads
for x in ${umi_folder[@]}; do
y=${x##/}
echo Working on $y
hts_Stats -F -L ${log_folder}${y}.log -U ${x} | #read stats
hts_SeqScreener -AL ${log_folder}${y}.log | #remove contaminants
hts_AdapterTrimmer -AL ${log_folder}${y}.log | #trim adaptors
hts_PolyATTrim -AL ${log_folder}${y}.log |
hts_QWindowTrim -AL ${log_folder}${y}.log | #remove low-quality
hts_NTrimmer -AL ${log_folder}${y}.log | #remove Ns
hts_Stats -AL ${log_folder}${y}.log -f ${clean_folder}${y} #read stats and save cleaned
done
conda deactivate
module unload miniconda
Expected behavior
Since the Lexogen 3' end which consists of 5' – A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC – 3' (adepter sequence same as default TruSeq), we expect that the sequence of PolyA tail and adapetr sequence will be trimmed.
Screenshots
Desktop (please complete the following information):
Additional context
Add any other context about the problem here.
The text was updated successfully, but these errors were encountered: